Sample ID: MP23-0432_rbcL
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:17 |
| Analysis completed | 2025-05-03 01:28:17 |
| Wall time | 0:0:0 hours |
Inconclusive
Outcome: The analyst should attempt subjective species identification at the genus level.
Reasoning: [Flag 1C] >3 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | NA |
|
Inconclusive taxonomic identity (Flag 1C) Planta. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
| Coverage of Planta | |
| Coverage of species in genus Planta | |
| Coverage of species in genus Planta in country of origin Indonesia |
Flag 5.1C:
The reference data are likely to be unreliable for this species
Reasoning: The given locus for this taxon is not present in reference database (0 entries)
There are 0 sequences in the reference database for Planta at the given locus rbcL.
Global occurrence records for Planta.
Note that the occurrence data are not exhaustive, and it is possible for this species to occur in regions not shown on the map.
Flag 5.2C:
The reference data offers little support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus rbcL
Flag 5.3C:
It’s unlikely that the true taxonomic identity is another species in this genus, because no others have been recorded in the sample’s country of origin
Reasoning: No species in genus have been observed in the country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus rbcL
| Taxa of interest detected? | False |
|
Flag 2B: Taxon of interest NOT detected in candidate species Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2B: 10-90% of related taxa have reference sequence(s) at the given locus |
|
| Locus | rbcL |
| Preliminary ID | Planta |
| Taxa of interest |
Nicotiana tabacum |
| Country | Indonesia |
| Host | NA |
| Sample ID | MP23-0432_rbcL |
| Query DNA sequence |
>MP23-0432_rbcL TGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGAC AAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCTGA AGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGAC TGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGCTACCACATCGAAGCCGTTGT TGGGGAGGAAAATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGG TTCTGTTACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGGTTTAAAGCTTTACG AGCTCTACGTCTGGAGGATTTGCGAATTCCTACCTCTTATTCCAAAACTTTCCAAGGCCC GCCTCACGGTATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTATTGGG ATGTACGATTAAACCAAAATTGGGATTATCCGCGAAAAACTACGGTAGAGCGGTTTATGA ATGTCTTCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCACAACCATT TATGCGTTGGAGAGACCGTTTCTGCTTCTGTGCCGAAGCAATTTATAAAGCACAGGCCGA AACAGGTGAAATTAAAGGGCATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGAT GAAAAGGGCTGTGTTTGCCAGAGAATTGGGAGCCCCTATCGTAATGCATGACTACTTAAC AGGGGGATTCACTGCAAATACTAGTTTAGCTCATTATTGCCGAGACAATGGTCTACTTCT TCACATCCACCGCGCAATGCATGCAGTTATTGATAGACAGAAGAATCATGGTATGCATTT CCGTGTACTAGCTAAAGCATTACGTATGTCTGGTGGGGATCATATTCACG
Flag 1C:
The analyst should attempt subjective species identification at the genus level
>3 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 35 | 24 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage |
|---|---|---|---|---|
| Xanthosoma mafaffa | 1 | 100.0% | 0.0 |
Database coverage of Candidate Xanthosoma mafaffaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Caladium praetermissum | 1 | 100.0% | 0.0 |
Database coverage of Candidate Caladium praetermissumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Xanthosoma sagittifolium | 2 | 100.0% | 0.0 |
Database coverage of Candidate Xanthosoma sagittifoliumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Alocasia cucullata | 1 | 100.0% | 0.0 |
Database coverage of Candidate Alocasia cucullataThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Xanthosoma violaceum | 1 | 99.9% | 0.0 |
Database coverage of Candidate Xanthosoma violaceumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Xanthosoma helleborifolium | 2 | 99.7% | 0.0 |
Database coverage of Candidate Xanthosoma helleborifoliumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Zomicarpella amazonica | 2 | 99.4% | 0.0 |
Database coverage of Candidate Zomicarpella amazonicaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Caladium lindenii | 2 | 99.4% | 0.0 |
Database coverage of Candidate Caladium lindeniiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Caladium humboldtii | 1 | 99.3% | 0.0 |
Database coverage of Candidate Caladium humboldtiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Caladium bicolor | 3 | 99.3% | 0.0 |
Database coverage of Candidate Caladium bicolorThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Scaphispatha gracilis | 1 | 99.3% | 0.0 |
Database coverage of Candidate Scaphispatha gracilisThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Filarum manserichense | 2 | 99.2% | 0.0 |
Database coverage of Candidate Filarum manserichenseThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Syngonium angustatum | 1 | 99.2% | 0.0 |
Database coverage of Candidate Syngonium angustatumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Syngonium podophyllum | 1 | 99.1% | 0.0 |
Database coverage of Candidate Syngonium podophyllumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Hapaline sp. HAR 056 | 1 | 99.1% | 0.0 |
Database coverage of Candidate Hapaline sp. HAR 056This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Syngonium auritum | 1 | 99.0% | 0.0 |
Database coverage of Candidate Syngonium auritumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Hapaline benthamiana | 1 | 98.9% | 0.0 |
Database coverage of Candidate Hapaline benthamianaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Chlorospatha sp. Chase 11912 | 1 | 98.9% | 0.0 |
Database coverage of Candidate Chlorospatha sp. Chase 11912This Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Peltandra virginica | 3 | 98.8% | 0.0 |
Database coverage of Candidate Peltandra virginicaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Arophyton buchetii | 1 | 98.7% | 0.0 |
Database coverage of Candidate Arophyton buchetiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Jasarum steyermarkii | 1 | 98.7% | 0.0 |
Database coverage of Candidate Jasarum steyermarkiiThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Typhonodorum lindleyanum | 2 | 98.6% | 0.0 |
Database coverage of Candidate Typhonodorum lindleyanumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Peltandra sagittifolia | 1 | 98.6% | 0.0 |
Database coverage of Candidate Peltandra sagittifoliaThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| Carlephyton glaucophyllum | 2 | 98.5% | 0.0 |
Database coverage of Candidate Carlephyton glaucophyllumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity. No database coverage information is available for this taxon. This is because database coverage is not evaluated when there are zero or >3 candidate species. |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | AJ007543 | Xanthosoma mafaffa rbcL gene, partial | 950 | 100.0% | 1883.64 | 0.00e+00 | 100.0% |
| 2 | NC_068799 | Caladium praetermissum isolate XLMRHYY chloroplast, complete genome | 950 | 100.0% | 1883.64 | 0.00e+00 | 100.0% |
| 3 | L10246 | Xanthosoma sagittifolium ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1883.64 | 0.00e+00 | 100.0% |
| 4 | MW628970 | Xanthosoma sagittifolium chloroplast, complete genome | 950 | 100.0% | 1883.64 | 0.00e+00 | 100.0% |
| 5 | NC_060696 | Alocasia cucullata chloroplast, complete genome | 950 | 100.0% | 1883.64 | 0.00e+00 | 100.0% |
| 6 | EU193180 | Xanthosoma violaceum isolate A42 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 904 | 95.2% | 1784.53 | 0.00e+00 | 99.9% |
| 7 | AM905790 | Xanthosoma helleborifolium plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1849.94 | 0.00e+00 | 99.7% |
| 8 | NC_051873 | Xanthosoma helleborifolium voucher MO:103054 chloroplast, complete genome | 950 | 100.0% | 1844.0 | 0.00e+00 | 99.5% |
| 9 | NC_051874 | Zomicarpella amazonica voucher MO:71763b chloroplast, complete genome | 950 | 100.0% | 1836.07 | 0.00e+00 | 99.4% |
| 10 | NC_068801 | Caladium lindenii isolate RMQNY chloroplast, complete genome | 950 | 100.0% | 1836.07 | 0.00e+00 | 99.4% |
| 11 | AM905788 | Caladium lindenii plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1826.16 | 0.00e+00 | 99.4% |
| 12 | AM905796 | Zomicarpella amazonica plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1826.16 | 0.00e+00 | 99.4% |
| 13 | NC_068800 | Caladium humboldtii isolate MNBHYY chloroplast, complete genome | 950 | 100.0% | 1828.14 | 0.00e+00 | 99.3% |
| 14 | ON707031 | Caladium bicolor isolate ESHYY chloroplast, complete genome | 950 | 100.0% | 1828.14 | 0.00e+00 | 99.3% |
| 15 | NC_060474 | Caladium bicolor chloroplast, complete sequence | 950 | 100.0% | 1828.14 | 0.00e+00 | 99.3% |
| 16 | AM905793 | Scaphispatha gracilis plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1818.23 | 0.00e+00 | 99.3% |
| 17 | AF497110 | Filarum manserichense ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1820.21 | 0.00e+00 | 99.2% |
| 18 | MN046894 | Syngonium angustatum chloroplast, complete genome | 950 | 100.0% | 1820.21 | 0.00e+00 | 99.2% |
| 19 | AM905795 | Filarum manserichense plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1810.3 | 0.00e+00 | 99.2% |
| 20 | NC_070391 | Syngonium podophyllum plastid, complete genome | 950 | 100.0% | 1812.28 | 0.00e+00 | 99.1% |
| 21 | AF497112 | Hapaline sp. HAR 056 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1812.28 | 0.00e+00 | 99.1% |
| 22 | EU193181 | Caladium bicolor isolate A149 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 904 | 95.2% | 1729.03 | 0.00e+00 | 99.1% |
| 23 | AM905789 | Syngonium auritum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1802.37 | 0.00e+00 | 99.0% |
| 24 | AM905787 | Hapaline benthamiana plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1794.44 | 0.00e+00 | 98.9% |
| 25 | AM905791 | Chlorospatha sp. Chase 11912 plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1794.44 | 0.00e+00 | 98.9% |
| 26 | AJ005628 | Peltandra virginica chloroplast rbcL gene | 950 | 100.0% | 1796.42 | 0.00e+00 | 98.8% |
| 27 | AM905815 | Peltandra virginica plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1786.51 | 0.00e+00 | 98.8% |
| 28 | AM905820 | Arophyton buchetii plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1778.58 | 0.00e+00 | 98.7% |
| 29 | AM905792 | Jasarum steyermarkii plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1778.58 | 0.00e+00 | 98.7% |
| 30 | EU193187 | Peltandra virginica isolate A108 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 904 | 95.2% | 1697.31 | 0.00e+00 | 98.7% |
| 31 | AM905814 | Typhonodorum lindleyanum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1770.65 | 0.00e+00 | 98.6% |
| 32 | KJ773731 | Peltandra sagittifolia ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 919 | 96.7% | 1719.11 | 0.00e+00 | 98.6% |
| 33 | EU193188 | Typhonodorum lindleyanum isolate A153 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 904 | 95.2% | 1689.38 | 0.00e+00 | 98.6% |
| 34 | NC_051871 | Carlephyton glaucophyllum voucher MO:101527 chloroplast, complete genome | 950 | 100.0% | 1772.64 | 0.00e+00 | 98.5% |
| 35 | AM905821 | Carlephyton glaucophyllum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 915 | 96.3% | 1703.26 | 0.00e+00 | 98.5% |
| 36 | OP279444 | Anubias barteri isolate JYH087 chloroplast, complete genome | 950 | 100.0% | 1764.71 | 0.00e+00 | 98.4% |
| 37 | NC_068131 | Anubias barteri isolate JYH085 chloroplast, complete genome | 950 | 100.0% | 1764.71 | 0.00e+00 | 98.4% |
| 38 | AM905758 | Aglaodorum griffithii plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1754.79 | 0.00e+00 | 98.4% |
| 39 | MN046881 | Aglaonema costatum chloroplast, complete genome | 950 | 100.0% | 1756.78 | 0.00e+00 | 98.3% |
| 40 | OR068729 | Aglaonema commutatum cultivar Kai Sa chloroplast, complete genome | 950 | 100.0% | 1756.78 | 0.00e+00 | 98.3% |
| 41 | OR068730 | Aglaonema commutatum cultivar Sapphire chloroplast, complete genome | 950 | 100.0% | 1756.78 | 0.00e+00 | 98.3% |
| 42 | OK094436 | Aglaonema hybrid cultivar cultivar Hong yan chloroplast, complete genome | 950 | 100.0% | 1756.78 | 0.00e+00 | 98.3% |
| 43 | NC_070237 | Aglaonema modestum chloroplast, complete genome | 950 | 100.0% | 1756.78 | 0.00e+00 | 98.3% |
| 44 | OK094435 | Aglaonema hybrid cultivar cultivar Hong jian chloroplast, complete genome | 950 | 100.0% | 1756.78 | 0.00e+00 | 98.3% |
| 45 | OR068731 | Aglaonema commutatum cultivar White Gem chloroplast, complete genome | 950 | 100.0% | 1756.78 | 0.00e+00 | 98.3% |
| 46 | NC_070395 | Aglaonema costatum plastid, complete genome | 950 | 100.0% | 1756.78 | 0.00e+00 | 98.3% |
| 47 | OK094434 | Aglaonema hybrid cultivar cultivar Red valentine chloroplast, complete genome | 950 | 100.0% | 1756.78 | 0.00e+00 | 98.3% |
| 48 | NC_070245 | Aglaonema hybrid cultivar cultivar Red Valentine chloroplast, complete genome | 950 | 100.0% | 1756.78 | 0.00e+00 | 98.3% |
| 49 | MN046884 | Anubias heterophylla chloroplast, complete genome | 950 | 100.0% | 1756.78 | 0.00e+00 | 98.3% |
| 50 | AM905794 | Ulearum sagittatum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1750.83 | 0.00e+00 | 98.3% |
| 51 | AM905757 | Aglaonema modestum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1746.87 | 0.00e+00 | 98.3% |
| 52 | AM905808 | Typhonium blumei plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1746.87 | 0.00e+00 | 98.3% |
| 53 | NC_051872 | Typhonium blumei voucher MO:103053 chloroplast, complete genome | 950 | 100.0% | 1748.85 | 0.00e+00 | 98.2% |
| 54 | MK262738 | Aglaonema hybrid cultivar cultivar Red Vein chloroplast, complete genome | 950 | 100.0% | 1748.85 | 0.00e+00 | 98.2% |
| 55 | OR068728 | Aglaonema commutatum cultivar White Horse Prince chloroplast, complete genome | 950 | 100.0% | 1748.85 | 0.00e+00 | 98.2% |
| 56 | MT872311 | Typhonium blumei chloroplast, complete genome | 950 | 100.0% | 1748.85 | 0.00e+00 | 98.2% |
| 57 | OR068725 | Aglaonema commutatum cultivar Silver Queen chloroplast, complete genome | 950 | 100.0% | 1748.85 | 0.00e+00 | 98.2% |
| 58 | MW338731 | Arisaema nepenthoides chloroplast, complete genome | 950 | 100.0% | 1748.85 | 0.00e+00 | 98.2% |
| 59 | MT863558 | Pinellia cordata chloroplast, complete genome | 950 | 100.0% | 1748.85 | 0.00e+00 | 98.2% |
| 60 | OR068724 | Aglaonema commutatum cultivar Snow White chloroplast, complete genome | 950 | 100.0% | 1748.85 | 0.00e+00 | 98.2% |
| 61 | NC_062430 | Anubias hastifolia chloroplast, complete genome | 950 | 100.0% | 1748.85 | 0.00e+00 | 98.2% |
| 62 | OP991877 | Pinellia sp. MQC-2023a chloroplast, complete genome | 950 | 100.0% | 1748.85 | 0.00e+00 | 98.2% |
| 63 | NC_050648 | Sauromatum giganteum chloroplast, complete genome | 950 | 100.0% | 1748.85 | 0.00e+00 | 98.2% |
| 64 | AM905773 | Callopsis volkensii plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1738.94 | 0.00e+00 | 98.2% |
| 65 | AM905756 | Anubias barteri plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1738.94 | 0.00e+00 | 98.2% |
| 66 | AM905805 | Protarum sechellarum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1738.94 | 0.00e+00 | 98.2% |
| 67 | OR068727 | Aglaonema commutatum cultivar San Remo chloroplast, complete genome | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 68 | KT025704 | Pinellia pedatisecta clone PP1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 69 | KT025702 | Pinellia tripartita clone PTP3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 70 | KT025703 | Pinellia tripartita clone PTP4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 71 | KT025701 | Pinellia tripartita clone PTP2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 72 | KT025706 | Pinellia pedatisecta clone PP3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 73 | NC_052862 | Pinellia peltata chloroplast, complete genome | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 74 | NC_058756 | Pinellia pedatisecta chloroplast, complete genome | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 75 | KT025705 | Pinellia pedatisecta clone PP2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 76 | NC_027681 | Pinellia ternata chloroplast, complete genome | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 77 | KM360757 | Dracunculus vulgaris ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 78 | MW451769 | Typhonium trifoliatum chloroplast, complete genome | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 79 | KT025708 | Pinellia pedatisecta clone PP5 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 80 | MN046890 | Pinellia pedatisecta chloroplast, complete genome | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 81 | OR772809 | Pinellia pedatisecta chloroplast, complete genome | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 82 | MW013550 | Pinellia pedatisecta chloroplast, complete genome | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 83 | KT025707 | Pinellia pedatisecta clone PP4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 84 | NC_056328 | Arisarum simorrhinum voucher MO:101519 chloroplast, complete genome | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 85 | MZ424447 | Arisaema heterophyllum voucher CPU:JTT YYTNX01 chloroplast, complete genome | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 86 | KT025709 | Pinellia pedatisecta clone PP6 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 87 | AF497113 | Typhonium venosum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 88 | KT025700 | Pinellia tripartita clone PTP1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1740.92 | 0.00e+00 | 98.1% |
| 89 | AM905812 | Dracunculus vulgaris plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1731.01 | 0.00e+00 | 98.1% |
| 90 | AM905807 | Pinellia pedatisecta plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1731.01 | 0.00e+00 | 98.1% |
| 91 | AM905797 | Arisarum vulgare plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1731.01 | 0.00e+00 | 98.1% |
| 92 | AM905798 | Ambrosina bassii plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1731.01 | 0.00e+00 | 98.1% |
| 93 | AM905752 | Podolasia stipitata plastid partial rbcL gene for ribulose-biphosphate carboxylase | 942 | 99.2% | 1725.06 | 0.00e+00 | 98.1% |
| 94 | AM905753 | Anaphyllopsis americana plastid partial rbcL gene for ribulose-biphosphate carboxylase | 942 | 99.2% | 1725.06 | 0.00e+00 | 98.1% |
| 95 | HM849791 | Arisarum vulgare ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 939 | 98.8% | 1719.11 | 0.00e+00 | 98.1% |
| 96 | KT794023 | Amorphophallus calabaricus isolate H.AM 1888 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1709.2 | 0.00e+00 | 98.1% |
| 97 | PQ772791 | Hayarum mirispathum chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 98 | OR583019 | Typhonium flagelliforme chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 99 | KT025711 | Typhonium flagelliforme clone TF2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 100 | MH270468 | Colocasia esculenta ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 101 | PP817741 | Colocasia fallax isolate CFABD01_wild chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 102 | KT025758 | Arisaema thunbergii clone ATB_MO4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 103 | KT025759 | Arisaema thunbergii clone ATB_JN1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 104 | PQ644296 | Pinellia ternata isolate GD12 chloroplast, partial genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 105 | KT025710 | Typhonium flagelliforme clone TF1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 106 | NC_048972 | Stylochaeton bogneri voucher 87579 (MO) chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 107 | KT025763 | Arisaema thunbergii subsp. geomundoense clone ATG_GG3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 108 | PP817745 | Colocasia oresbia isolate CORMY01_wild chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 109 | KT025756 | Arisaema thunbergii clone ATB_MO2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 110 | PQ644294 | Pinellia ternata isolate PD1 chloroplast, partial genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 111 | KT025755 | Arisaema thunbergii clone ATB_MO1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 112 | PP817747 | Colocasia spongifolia isolate CSFVN01_wild haplogroup CIII chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 113 | KT025713 | Typhonium flagelliforme clone TF4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 114 | OR068726 | Aglaonema commutatum cultivar Pattaya Beauty chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 115 | MT447084 | Colocasia esculenta cultivar redbud chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 116 | KT025757 | Arisaema thunbergii clone ATB_MO3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 117 | KT025761 | Arisaema thunbergii subsp. geomundoense clone ATG_GG1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 118 | NC_051952 | Steudnera colocasiifolia voucher MO:77954a chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 119 | KT025760 | Arisaema thunbergii clone ATB_JN2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 120 | PP817746 | Colocasia oresbia isolate CORMY02_wild chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 121 | OP589403 | Colocasia esculenta chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 122 | JN105690 | Colocasia esculenta isolate RR chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 123 | PP817742 | Colocasia formosana isolate CFOTW03_wild haplogroup CIII chloroplast, complete genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 124 | KM360649 | Arisarum proboscideum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 125 | NC_060475 | Leucocasia gigantea chloroplast, complete sequence | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 126 | KT025762 | Arisaema thunbergii subsp. geomundoense clone ATG_GG2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 127 | PQ644297 | Pinellia ternata isolate PW2 chloroplast, partial genome | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 128 | L10250 | Lasia spinosa ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1732.99 | 0.00e+00 | 98.0% |
| 129 | AM905816 | Culcasia liberica plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1723.08 | 0.00e+00 | 98.0% |
| 130 | AM905759 | Nephthytis afzelii plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1723.08 | 0.00e+00 | 98.0% |
| 131 | AM905804 | Ariopsis peltata plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1723.08 | 0.00e+00 | 98.0% |
| 132 | AM905811 | Helicodiceros muscivorus plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1723.08 | 0.00e+00 | 98.0% |
| 133 | AM905800 | Colocasia esculenta plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1723.08 | 0.00e+00 | 98.0% |
| 134 | AM905801 | Steudnera colocasiifolia plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1723.08 | 0.00e+00 | 98.0% |
| 135 | HM849907 | Colocasia esculenta ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 939 | 98.8% | 1711.19 | 0.00e+00 | 98.0% |
| 136 | KT794086 | Amorphophallus stuhlmannii isolate H.AM 1511 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1701.27 | 0.00e+00 | 98.0% |
| 137 | GU067589 | Dracunculus vulgaris ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1732.99 | 0.00e+00 | 97.9% |
| 138 | KT025712 | Typhonium flagelliforme clone TF3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 139 | PQ644295 | Pinellia ternata isolate CL4 chloroplast, partial genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 140 | MN046892 | Schismatoglottis calyptrata chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 141 | KT025698 | Pinellia ternata clone PT4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 142 | KT025696 | Pinellia ternata clone PT2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 143 | PP817748 | Colocasia sp. (in: monocots) isolate CxVN01_wild haplogroup CIII chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 144 | GU067572 | Arum dioscoridis ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 145 | NC_048970 | Lasia spinosa voucher 71753 (MO) chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 146 | PP817734 | Colocasia esculenta isolate CESBD02_wild haplogroup CI chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 147 | AF497063 | Amorphophallus baumannii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 148 | GU067573 | Arum elongatum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 149 | GU067567 | Arum balansanum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 150 | GU067575 | Arum gratum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 151 | KT025695 | Pinellia ternata clone PT1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 152 | PP817735 | Colocasia esculenta isolate CESBD03_wild haplogroup CI chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 153 | NC_064687 | Arisaema decipiens chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 154 | ON462056 | Pinellia ternata chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 155 | GU067586 | Arum purpureospathum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 156 | MT193722 | Pinellia ternata chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 157 | AF497078 | Amorphophallus hirtus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 158 | PP817744 | Colocasia lihengiae isolate CLIVN05_wild haplogroup CIII chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 159 | MT447085 | Colocasia esculenta cultivar lipu chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 160 | NC_016753 | Colocasia esculenta chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 161 | PP811809 | Colocasia esculenta chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 162 | PP817743 | Colocasia lihengiae isolate CLIVN04_wild haplogroup CIII chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 163 | KT025699 | Pinellia ternata clone PT5 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 164 | PP475493 | Colocasia esculenta isolate CESAU24_wild haplogroup Clade III chloroplast, complete genome | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 165 | KT025697 | Pinellia ternata clone PT3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 166 | LC767269 | Colocasia esculenta Taimo chloroplast DNA, complete sequence | 950 | 100.0% | 1725.06 | 0.00e+00 | 97.9% |
| 167 | AM905781 | Piptospatha ridleyi plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1715.15 | 0.00e+00 | 97.9% |
| 168 | AM905776 | Stylochaeton bogneri plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1715.15 | 0.00e+00 | 97.9% |
| 169 | AM905749 | Lasia spinosa plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1715.15 | 0.00e+00 | 97.9% |
| 170 | AM905738 | Stenospermation ulei plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1715.15 | 0.00e+00 | 97.9% |
| 171 | AM905782 | Schismatoglottis trifasciata plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1715.15 | 0.00e+00 | 97.9% |
| 172 | AM905809 | Arum hygrophilum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1715.15 | 0.00e+00 | 97.9% |
| 173 | AM905751 | Pycnospatha arietina plastid partial rbcL gene for ribulose-biphosphate carboxylase | 942 | 99.2% | 1709.2 | 0.00e+00 | 97.9% |
| 174 | DQ005607 | Arum maculatum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 941 | 99.1% | 1707.22 | 0.00e+00 | 97.9% |
| 175 | KF022498 | Pinellia ternata isolate 01 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 937 | 98.6% | 1699.29 | 0.00e+00 | 97.9% |
| 176 | KT794061 | Amorphophallus natolii isolate HBG 2012-G-55 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1693.34 | 0.00e+00 | 97.9% |
| 177 | KT794021 | Amorphophallus bufo isolate H.AM 1575 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1693.34 | 0.00e+00 | 97.9% |
| 178 | KT794088 | Amorphophallus synandrifer isolate H.AM 1089 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1693.34 | 0.00e+00 | 97.9% |
| 179 | AB586206 | Remusatia sp. SH-2010 chloroplast gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds, isolate: T967 | 925 | 97.4% | 1683.43 | 0.00e+00 | 97.9% |
| 180 | L10255 | Ariopsis peltata ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1721.1 | 0.00e+00 | 97.8% |
| 181 | GU067574 | Arum euxinum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1721.1 | 0.00e+00 | 97.8% |
| 182 | GU067585 | Arum pictum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1721.1 | 0.00e+00 | 97.8% |
| 183 | GU067579 | Arum jacquemontii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1721.1 | 0.00e+00 | 97.8% |
| 184 | GU067570 | Arum creticum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1721.1 | 0.00e+00 | 97.8% |
| 185 | GU067566 | Arum apulum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1721.1 | 0.00e+00 | 97.8% |
| 186 | GU067588 | Arum sintenisii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1721.1 | 0.00e+00 | 97.8% |
| 187 | GU067576 | Arum hygrophilum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1721.1 | 0.00e+00 | 97.8% |
| 188 | MN046885 | Arisaema franchetianum chloroplast, complete genome | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 189 | GU067569 | Arum concinnatum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 190 | AF497070 | Amorphophallus corrugatus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 191 | PQ644298 | Pinellia ternata isolate ZB2 chloroplast, partial genome | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 192 | PP817740 | Colocasia esculenta isolate CESVN15_wild haplogroup CIII chloroplast, complete genome | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 193 | DQ012497 | Amorphophallus laoticus ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 194 | AF497105 | Amorphophallus zenkeri ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 195 | PP817739 | Colocasia esculenta isolate CESTH07_wild haplogroup CIII chloroplast, complete genome | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 196 | HQ901583 | Arum italicum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 197 | DQ012499 | Amorphophallus mossambicensis ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 198 | PV068279 | Arisaema lackneri chloroplast, complete genome | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 199 | MN046889 | Montrichardia arborescens chloroplast, complete genome | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 200 | AF497083 | Amorphophallus lewallei ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 201 | NC_072165 | Arisaema prazeri voucher A399_A chloroplast, complete genome | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 202 | AF497089 | Amorphophallus napiger ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 203 | LC851499 | Colocasia esculenta CSW240710 chloroplast DNA, complete genome | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 204 | PQ644299 | Pinellia ternata isolate ZT3 chloroplast, partial genome | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 205 | AF497074 | Amorphophallus eichleri ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 206 | PP817738 | Colocasia esculenta isolate CESTH06_wild haplogroup CIII chloroplast, complete genome | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 207 | DQ012501 | Amorphophallus pendulus ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 208 | AF497100 | Amorphophallus symonianus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 209 | AF497061 | Amorphophallus angolensis ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 210 | NC_047235 | Stenospermation multiovulatum voucher 82903b (MO) chloroplast, complete genome | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.8% |
| 211 | AF497060 | Amorphophallus abyssinicus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 949 | 99.9% | 1715.15 | 0.00e+00 | 97.8% |
| 212 | AF497062 | Amorphophallus ankarana ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 949 | 99.9% | 1715.15 | 0.00e+00 | 97.8% |
| 213 | AM905817 | Cercestis mirabilis plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1711.19 | 0.00e+00 | 97.8% |
| 214 | DQ012492 | Amorphophallus interruptus ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 947 | 99.7% | 1711.19 | 0.00e+00 | 97.8% |
| 215 | AM905813 | Eminium spiculatum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1707.22 | 0.00e+00 | 97.8% |
| 216 | AM905822 | Bucephalandra motleyana plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1707.22 | 0.00e+00 | 97.8% |
| 217 | AM905803 | Remusatia vivipara plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1707.22 | 0.00e+00 | 97.8% |
| 218 | AM905784 | Aridarum nicolsonii plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1707.22 | 0.00e+00 | 97.8% |
| 219 | AM905818 | Montrichardia arborescens plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1707.22 | 0.00e+00 | 97.8% |
| 220 | AM905750 | Cyrtosperma macrotum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 942 | 99.2% | 1701.27 | 0.00e+00 | 97.8% |
| 221 | GU067584 | Arum palaestinum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 940 | 98.9% | 1699.29 | 0.00e+00 | 97.8% |
| 222 | KT794032 | Amorphophallus dzui isolate H.AM 523 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1685.42 | 0.00e+00 | 97.8% |
| 223 | KT794077 | Amorphophallus rostratus isolate H.AM 1559 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1685.42 | 0.00e+00 | 97.8% |
| 224 | KT794059 | Amorphophallus maximus isolate H.AM 67 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1685.42 | 0.00e+00 | 97.8% |
| 225 | KT794036 | Amorphophallus erythrorrhachis isolate H.AM 1468 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1685.42 | 0.00e+00 | 97.8% |
| 226 | KT794045 | Amorphophallus hildebrandtii isolate H.AM 1523 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1685.42 | 0.00e+00 | 97.8% |
| 227 | KT794060 | Amorphophallus myosuroides isolate H.AM 1500 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1685.42 | 0.00e+00 | 97.8% |
| 228 | KT794054 | Amorphophallus longicomus isolate H.AM 177 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1685.42 | 0.00e+00 | 97.8% |
| 229 | KT794026 | Amorphophallus consimilis isolate H.AM 1150 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1685.42 | 0.00e+00 | 97.8% |
| 230 | KT794012 | Amorphophallus andranogidroensis isolate H.AM 1423 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1685.42 | 0.00e+00 | 97.8% |
| 231 | KT794094 | Amorphophallus verticillatus isolate H.AM 1341 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1685.42 | 0.00e+00 | 97.8% |
| 232 | GU067565 | Arum cylindraceum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.7% |
| 233 | GU067581 | Arum cyrenaicum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1717.13 | 0.00e+00 | 97.7% |
| 234 | GU067568 | Arum byzantinum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1713.17 | 0.00e+00 | 97.7% |
| 235 | NC_072945 | Amorphophallus coaetaneus chloroplast, complete genome | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 236 | NC_082907 | Amorphophallus krausei chloroplast, complete genome | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 237 | AF497081 | Amorphophallus krausei ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 238 | KM360654 | Arum maculatum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 239 | DQ012494 | Amorphophallus johnsonii ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 240 | AY298817 | Arisaema triphyllum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 241 | DQ012496 | Amorphophallus lanuginosus ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 242 | GU067583 | Arum nigrum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 243 | AF497096 | Amorphophallus rhizomatosus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 244 | OR416863 | Amorphophallus krausei chloroplast, complete genome | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 245 | AF497072 | Amorphophallus dracontioides ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 246 | AJ005629 | Arisaema triphyllum chloroplast rbcL gene | 950 | 100.0% | 1709.2 | 0.00e+00 | 97.7% |
| 247 | AM905810 | Biarum tenuifolium plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1699.29 | 0.00e+00 | 97.7% |
| 248 | AM905755 | Lasimorpha senegalensis plastid partial rbcL gene for ribulose-biphosphate carboxylase | 942 | 99.2% | 1693.34 | 0.00e+00 | 97.7% |
| 249 | AM905747 | Dracontium polyphyllum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 942 | 99.2% | 1693.34 | 0.00e+00 | 97.7% |
| 250 | AM905754 | Dracontioides desciscens plastid partial rbcL gene for ribulose-biphosphate carboxylase | 942 | 99.2% | 1693.34 | 0.00e+00 | 97.7% |
| 251 | KY887066 | Amorphophallus krausei isolate MLC_7 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1677.49 | 0.00e+00 | 97.7% |
| 252 | MK206690 | Stenospermation andreanum voucher Zuluaga A. 321 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 928 | 97.7% | 1673.52 | 0.00e+00 | 97.7% |
| 253 | GU067587 | Arum rupicola ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1713.17 | 0.00e+00 | 97.6% |
| 254 | NC_086582 | Amorphophallus kiusianus chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 255 | KT025745 | Arisaema takesimense clone AT_NR1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 256 | MN046882 | Alocasia navicularis chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 257 | KT025724 | Arisaema amurense var. serratum clone AAS_YC ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 258 | KY769273 | Colocasia esculenta chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 259 | DQ012486 | Amorphophallus declinatus ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 260 | KT025721 | Arisaema amurense var. serratum clone AAS_WJ ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 261 | PP936071 | Amorphophallus krausei chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 262 | AF497090 | Amorphophallus ochroleucus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 263 | NC_085264 | Arisaema amurense chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 264 | KT025742 | Arisaema serratum clone AS_JL ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 265 | KT025738 | Arisaema serratum clone AS_GJ ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 266 | KT025733 | Arisaema heterophyllum clone AH_CY ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 267 | KT025726 | Arisaema amurense var. serratum clone AAS_AS ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 268 | KT025732 | Arisaema heterophyllum clone AH_TY ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 269 | KT025739 | Arisaema serratum clone AS_JJ ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 270 | MZ380241 | Arisaema bockii chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 271 | MZ424448 | Arisaema heterophyllum chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 272 | AJ005630 | Amorphophallus rivieri chloroplast rbcL gene | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 273 | KT025736 | Arisaema serratum clone AS_KY ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 274 | AF497068 | Amorphophallus coaetaneus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 275 | KT025744 | Arisaema takesimense clone AT_BR2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 276 | KT025734 | Arisaema heterophyllum clone AH_AS ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 277 | AF497095 | Amorphophallus pygmaeus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 278 | DQ859161 | Arisaema amurense voucher C1295 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 279 | KT025722 | Arisaema amurense var. serratum clone AAS_JJ ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 280 | KT025730 | Arisaema heterophyllum clone AH_SC ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 281 | KT025723 | Arisaema amurense var. serratum clone AAS_TY ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 282 | NC_067990 | Amorphophallus albus isolate YJ-065 chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 283 | KT025740 | Arisaema serratum clone AS_IJ ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 284 | OR438676 | Amorphophallus albus chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 285 | AF497080 | Amorphophallus konjac ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 286 | KT025746 | Arisaema takesimense clone AT_NR2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 287 | KT025737 | Arisaema serratum clone AS_JS ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 288 | NC_046702 | Amorphophallus konjac chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 289 | KT025717 | Arisaema amurense clone AA_TY ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 290 | OR438675 | Amorphophallus konjac chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 291 | KT025741 | Arisaema serratum clone AS_UR ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 292 | AF497093 | Amorphophallus pingbianensis ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 293 | OM066870 | Amorphophallus albus chromosome 2 mitochondrion, complete sequence | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 294 | KT025716 | Arisaema amurense clone AA_JJ ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 295 | KT025743 | Arisaema takesimense clone AT_BR1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 296 | AF497079 | Amorphophallus hottae ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 297 | KT025747 | Arisaema takesimense clone AT_NSJ1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 298 | AF497065 | Amorphophallus brevispathus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 299 | KT025715 | Arisaema amurense clone AA_YS ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 300 | AF497088 | Amorphophallus napalensis ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 301 | NC_063965 | Arisaema heterophyllum chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 302 | DQ012489 | Amorphophallus glossophyllus ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 303 | KT025714 | Arisaema amurense clone AA_KY ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 304 | KT025719 | Arisaema amurense clone AA_JS ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 305 | KT025725 | Arisaema amurense var. serratum clone AAS_GJ ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 306 | KT025735 | Arisaema heterophyllum clone AH_GP ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 307 | JQ933213 | Alocasia odora voucher P.Boyce, s.n., (K) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 308 | NC_054336 | Homalomena occulta chloroplast, complete genome | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 309 | KT025731 | Arisaema heterophyllum clone AH_KY ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 310 | AF497067 | Amorphophallus cirrifer ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 311 | KT025748 | Arisaema takesimense clone AT_NSJ2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 312 | KT025720 | Arisaema amurense clone AA_AS ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 313 | KT025718 | Arisaema amurense clone AA_IJ ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.6% |
| 314 | KT025728 | Arisaema erubescens clone AE_QS2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 949 | 99.9% | 1699.29 | 0.00e+00 | 97.6% |
| 315 | NC_051541 | Arisaema erubescens chloroplast, complete genome | 949 | 99.9% | 1699.29 | 0.00e+00 | 97.6% |
| 316 | NC_065735 | Arisaema flavum chloroplast, complete genome | 949 | 99.9% | 1699.29 | 0.00e+00 | 97.6% |
| 317 | KT025727 | Arisaema erubescens clone AE_GS1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 949 | 99.9% | 1699.29 | 0.00e+00 | 97.6% |
| 318 | AM905769 | Gorgonidium intermedium plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1691.36 | 0.00e+00 | 97.6% |
| 319 | KC466583 | Arisaema amurense ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 945 | 99.5% | 1691.36 | 0.00e+00 | 97.6% |
| 320 | AM905785 | Amorphophallus hottae plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1691.36 | 0.00e+00 | 97.6% |
| 321 | AM905802 | Alocasia odora plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1691.36 | 0.00e+00 | 97.6% |
| 322 | AM905767 | Gorgonidium sp. CL-2007 plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1691.36 | 0.00e+00 | 97.6% |
| 323 | AM905806 | Arisaema franchetianum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1691.36 | 0.00e+00 | 97.6% |
| 324 | AM905768 | Incarum pavonii plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1691.36 | 0.00e+00 | 97.6% |
| 325 | KT794079 | Amorphophallus saururus isolate H.AM 026 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 326 | KT794038 | Amorphophallus fuscus isolate H.AM 1294 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 327 | KT794091 | Amorphophallus terrestris isolate H.AM 1568 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 328 | KT794097 | Amorphophallus yuloensis isolate H.AM 337 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 329 | KT794053 | Amorphophallus linearis isolate HBG 2012-G-11 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 330 | KT794073 | Amorphophallus pulchellus isolate H.AM 1589 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 331 | KT794025 | Amorphophallus cicatricifer isolate H.AM 368 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 332 | KT794050 | Amorphophallus kachinensis isolate H.AM 671 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 333 | KT794009 | Amorphophallus aberrans isolate H.AM 947 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 334 | KT794082 | Amorphophallus serrulatus isolate H.AM 1430 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 335 | KT794018 | Amorphophallus atroviridis isolate H.AM 683 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 336 | KT794083 | Amorphophallus sinuatus isolate H.AM 1320 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 337 | KT794058 | Amorphophallus manta isolate H.AM 1760 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 338 | KT794063 | Amorphophallus obscurus isolate H.AM 1147 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 339 | KT794028 | Amorphophallus croatii isolate H.AM 1432 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 340 | KT794057 | Amorphophallus mangelsdorffii isolate H.AM 1422 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 341 | KT794046 | Amorphophallus interruptus isolate H.AM 522 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 342 | KT794084 | Amorphophallus sizemoreae isolate H.AM 983 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 343 | KT794014 | Amorphophallus antsingyensis isolate H.AM 099 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 344 | KT794029 | Amorphophallus cruddasianus isolate H.AM 967 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 345 | KT794093 | Amorphophallus tuberculatus isolate H.AM 1319 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 346 | KT794047 | Amorphophallus josefbogneri isolate H.AM 1396 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1677.49 | 0.00e+00 | 97.6% |
| 347 | KY887097 | Amorphophallus konjac isolate WFSY_4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 348 | KY887065 | Amorphophallus krausei isolate JDYSD_5 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 349 | KY887106 | Amorphophallus krausei isolate PZQ_15 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 350 | KY887040 | Amorphophallus yuloensis isolate DYK_5 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 351 | KY887086 | Amorphophallus krausei isolate JDYSD_9 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 352 | KY887109 | Amorphophallus krausei isolate PTZ_1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 353 | KY887054 | Amorphophallus krausei isolate JDYSD_10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 354 | KY887105 | Amorphophallus konjac isolate WFSY_12 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 355 | KY887090 | Amorphophallus krausei isolate MLC_5 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 356 | KY887059 | Amorphophallus konjac isolate YXSBQ_12 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 357 | KY887082 | Amorphophallus krausei isolate PZQ_10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 358 | KY887079 | Amorphophallus krausei isolate DYKX_6 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 359 | KY887067 | Amorphophallus konjac isolate WFSY_10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 360 | KY887089 | Amorphophallus krausei isolate MLC_3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 361 | KY887043 | Amorphophallus krausei isolate PZQ_14 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 362 | KY887083 | Amorphophallus krausei isolate DYKX_4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 363 | KY887033 | Amorphophallus krausei isolate JDYSD_4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 364 | KY887081 | Amorphophallus krausei isolate DYKX_3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 365 | KY887068 | Amorphophallus krausei isolate BNLYT_1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 366 | KY887080 | Amorphophallus krausei isolate MLC_2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 367 | KY887107 | Amorphophallus yuloensis isolate DYK_4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 368 | KY887099 | Amorphophallus krausei isolate PZQ_13 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 369 | KY887058 | Amorphophallus konjac isolate YXSBQ_13 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 370 | KY887087 | Amorphophallus konjac isolate YXSBQ_11 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 371 | KY887078 | Amorphophallus krausei isolate PZQ_11 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 372 | KY887098 | Amorphophallus konjac isolate WFSY_7 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 373 | KY887092 | Amorphophallus konjac isolate WFSY_8 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 374 | KY887055 | Amorphophallus krausei isolate BNLYT_2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 375 | KY887096 | Amorphophallus konjac isolate WFSY_6 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 376 | KY887050 | Amorphophallus krausei isolate JDYSD_3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 377 | KY887061 | Amorphophallus krausei isolate JDYSD_8 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 378 | KY887039 | Amorphophallus krausei isolate JDYSD_6 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 379 | KY887051 | Amorphophallus konjac isolate YXSBQ_9 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 380 | KY887044 | Amorphophallus konjac isolate WFSY_9 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 381 | KY887091 | Amorphophallus konjac isolate WFSY_5 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 930 | 97.9% | 1669.56 | 0.00e+00 | 97.6% |
| 382 | AF497066 | Amorphophallus canaliculatus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1701.27 | 0.00e+00 | 97.5% |
| 383 | AF497086 | Amorphophallus maxwellii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1697.31 | 0.00e+00 | 97.5% |
| 384 | AF497099 | Amorphophallus sumawongii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1697.31 | 0.00e+00 | 97.5% |
| 385 | KT025751 | Arisaema ringens clone AR_GJA ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 386 | AF497106 | Pseudodracontium harmandii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 387 | AF497073 | Amorphophallus eburneus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 388 | AF497075 | Amorphophallus galbra ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 389 | AF497111 | Gonatopus angustus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 390 | DQ012500 | Amorphophallus paeoniifolius var. bangkokensis ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 391 | AF497076 | Amorphophallus henryi ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 392 | OM912764 | Cryptocoryne striolata chloroplast, complete genome | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 393 | KT025752 | Arisaema ringens clone AR_JC ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 394 | AF497077 | Amorphophallus hirsutus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 395 | NC_086625 | Amorphophallus paeoniifolius chloroplast, complete genome | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 396 | KT025753 | Arisaema ringens clone AR_SGP ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 397 | NC_088771 | Cryptocoryne crispatula var. balansae chloroplast, complete genome | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 398 | OM950936 | Cryptocoryne nurii chloroplast, complete genome | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 399 | OM513675 | Cryptocoryne longicauda chloroplast, complete genome | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 400 | KT025754 | Arisaema ringens clone AR_CJ ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 401 | AF497091 | Amorphophallus paeoniifolius ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 402 | KT025750 | Arisaema ringens clone AR_TY ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 403 | MN551187 | Philodendron lanceolatum chloroplast, complete genome | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 404 | AF497107 | Pseudodracontium lanceolatum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 405 | NC_044118 | Arisaema ringens chloroplast, complete genome | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 406 | DQ012485 | Amorphophallus dactylifer ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 407 | AF497109 | Arisaema tortuosum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 408 | KT025749 | Arisaema ringens clone AR_GJ ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.5% |
| 409 | AF497092 | Amorphophallus palawanensis ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 949 | 99.9% | 1691.36 | 0.00e+00 | 97.5% |
| 410 | KT025729 | Arisaema erubescens clone AE_QS3 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 949 | 99.9% | 1691.36 | 0.00e+00 | 97.5% |
| 411 | AM905735 | Anthurium acaule plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1683.43 | 0.00e+00 | 97.5% |
| 412 | DQ012491 | Amorphophallus hohenackeri ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 945 | 99.5% | 1683.43 | 0.00e+00 | 97.5% |
| 413 | AM905763 | Gearum brasiliense plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1683.43 | 0.00e+00 | 97.5% |
| 414 | AM905779 | Cryptocoryne lingua plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1683.43 | 0.00e+00 | 97.5% |
| 415 | AM905771 | Synandrospadix vermitoxicus plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1683.43 | 0.00e+00 | 97.5% |
| 416 | AM905774 | Homalomena magna plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1683.43 | 0.00e+00 | 97.5% |
| 417 | AM905780 | Lagenandra ovata plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1683.43 | 0.00e+00 | 97.5% |
| 418 | KT794041 | Amorphophallus gomboczianus isolate H.AM 1412 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 419 | KT794030 | Amorphophallus curvistylis isolate H.AM 1413 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 420 | KT794037 | Amorphophallus excentricus isolate H.AM 184 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 421 | KT794064 | Amorphophallus ongsakulii isolate HBG 2007-G-114 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 422 | KT794081 | Amorphophallus schmidtiae isolate H.AM 1433 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 423 | KT794055 | Amorphophallus lunatus isolate H.AM 1189 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 424 | KT794065 | Amorphophallus operculatus isolate H.AM 994 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 425 | KT794095 | Amorphophallus vogelianus isolate H.AM 1174 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 426 | AM905760 | Pseudohydrosme gabunensis plastid partial rbcL gene for ribulose-biphosphate carboxylase | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 427 | KT794011 | Amorphophallus albus isolate H.AM 1222 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 428 | KT794076 | Amorphophallus reflexus isolate H.AM 1505 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 429 | KT794016 | Amorphophallus asterostigmatus isolate H.AM 1299 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 430 | KT794013 | Amorphophallus angulatus isolate H.AM 1823 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 431 | KT794039 | Amorphophallus gallowayi isolate H.AM 1431 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 432 | KT794056 | Amorphophallus macrorhizus isolate H.AM 990 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 433 | KT794024 | Amorphophallus carneus isolate H.AM 464 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 434 | KT794015 | Amorphophallus aphyllus isolate HBG 2007-G-045 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 435 | KT794051 | Amorphophallus kiusianus isolate HBG 2007-G-92 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 934 | 98.3% | 1669.56 | 0.00e+00 | 97.5% |
| 436 | GU067582 | Arum maculatum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1713.17 | 0.00e+00 | 97.4% |
| 437 | GU067580 | Arum korolkowii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast | 950 | 100.0% | 1705.24 | 0.00e+00 | 97.4% |
| 438 | AF497094 | Amorphophallus pusillus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1693.34 | 0.00e+00 | 97.4% |
| 439 | AF497104 | Amorphophallus yunnanensis ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1685.42 | 0.00e+00 | 97.4% |
| 440 | AF497098 | Amorphophallus smithsonianus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1685.42 | 0.00e+00 | 97.4% |
| 441 | DQ012482 | Amorphophallus amygdaloides ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1685.42 | 0.00e+00 | 97.4% |
| 442 | AF497069 | Amorphophallus commutatus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1685.42 | 0.00e+00 | 97.4% |
| 443 | DQ012504 | Amorphophallus thaiensis ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1685.42 | 0.00e+00 | 97.4% |
| 444 | AJ005627 | Anthuriumscherzerianum chloroplast rbcL gene | 950 | 100.0% | 1685.42 | 0.00e+00 | 97.4% |
| 445 | NC_047233 | Spathiphyllum patulinervum chloroplast, complete genome | 950 | 100.0% | 1685.42 | 0.00e+00 | 97.4% |
| 446 | NC_082906 | Amorphophallus yunnanensis chloroplast, complete genome | 950 | 100.0% | 1685.42 | 0.00e+00 | 97.4% |
| 447 | AJ005624 | Zamioculcas zamiifolia chloroplast rbcL gene | 950 | 100.0% | 1685.42 | 0.00e+00 | 97.4% |
| 448 | MN046895 | Taccarum caudatum chloroplast, complete genome | 950 | 100.0% | 1685.42 | 0.00e+00 | 97.4% |
| 449 | MK636779 | Alocasia fornicata chloroplast, complete genome | 950 | 100.0% | 1685.42 | 0.00e+00 | 97.4% |
| 450 | AM905761 | Anchomanes difformis plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1679.47 | 0.00e+00 | 97.4% |
| 451 | AM905786 | Pseudodracontium lacourii plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1675.5 | 0.00e+00 | 97.4% |
| 452 | AM905746 | Epipremnum pinnatum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1675.5 | 0.00e+00 | 97.4% |
| 453 | AM905766 | Mangonia tweedieana plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1675.5 | 0.00e+00 | 97.4% |
| 454 | AM905775 | Philodendron deltoideum plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1675.5 | 0.00e+00 | 97.4% |
| 455 | AM905778 | Zamioculcas zamiifolia plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1675.5 | 0.00e+00 | 97.4% |
| 456 | AM905744 | Alloschemone occidentalis plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1675.5 | 0.00e+00 | 97.4% |
| 457 | JQ933275 | Colocasia esculenta voucher Chase, 10669, (K) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid | 950 | 100.0% | 1689.38 | 0.00e+00 | 97.3% |
| 458 | AF497084 | Amorphophallus longituberosus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1679.47 | 0.00e+00 | 97.3% |
| 459 | NC_086855 | Amorphophallus tonkinensis chloroplast, complete genome | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 460 | DQ012495 | Amorphophallus konkanensis ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 461 | DQ012490 | Amorphophallus hewitii ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 462 | OL631930 | Philodendron hederaceum chloroplast, complete genome | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 463 | AF497103 | Amorphophallus variabilis ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 464 | AF497085 | Amorphophallus margaritifer ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 465 | AF497102 | Amorphophallus titanum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 466 | AJ005631 | Dieffenbachia sp. Qiu 96007 chloroplast rbcL gene | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 467 | NC_064988 | Philodendron hederaceum chloroplast, complete genome | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 468 | AF497071 | Amorphophallus decus-silvae ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 469 | NC_082227 | Monstera deliciosa chloroplast, complete genome | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 470 | MN551188 | Anchomanes hookeri chloroplast, complete genome | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 471 | NC_048973 | Zamioculcas zamiifolia voucher 97755 (MO) chloroplast, complete genome | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 472 | NC_056329 | Amorphophallus titanum voucher MO:103059 chloroplast, complete genome | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 473 | AF497108 | Anchomanes difformis ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 474 | AF497097 | Amorphophallus sagittarius ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1677.49 | 0.00e+00 | 97.3% |
| 475 | AM905739 | Rhodospatha oblongata plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1667.58 | 0.00e+00 | 97.3% |
| 476 | L10248 | Montrichardia arborescens ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1681.45 | 0.00e+00 | 97.2% |
| 477 | L10254 | Anchomanes difformis ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1681.45 | 0.00e+00 | 97.2% |
| 478 | DQ012484 | Amorphophallus borneensis ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 479 | DQ012498 | Amorphophallus longiconnectivus ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 480 | KF632846 | Calla palustris voucher C945 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 481 | NC_035499 | Zantedeschia aethiopica chloroplast, complete sequence | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 482 | AF497082 | Amorphophallus lambii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 483 | PP754463 | Pothos chinensis chloroplast, complete genome | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 484 | OL435717 | Dieffenbachia seguine voucher Tippery 1262 (UWW) ribulose-biphosphate carboxylase (rbcL) gene, partial cds; mitochondrial | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 485 | MN046887 | Calla palustris chloroplast, complete genome | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 486 | NC_060847 | Cryptocoryne elliptica chloroplast, complete genome | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 487 | AJ005625 | Scindapsus aureus chloroplast rbcL gene | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 488 | MK286107 | Epipremnum aureum chloroplast, complete genome | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 489 | AF497064 | Amorphophallus beccarii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast gene for chloroplast product | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 490 | OK539588 | Epipremnum aureum plastid, complete genome | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 491 | NC_030371 | Spathiphyllum kochii isolate GP chloroplast, complete genome | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 492 | NC_045125 | Spathiphyllum cannifolium chloroplast, complete genome | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 493 | NC_027272 | Dieffenbachia seguine chloroplast, complete genome | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 494 | AJ005626 | Spathiphyllum clevelandii chloroplast rbcL gene | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 495 | AJ235807 | Spathiphyllum wallisii chloroplast rbcL gene | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 496 | MK391158 | Spathiphyllum kochii cultivar Parrish chloroplast, complete genome | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 497 | AJ005623 | Philodendron oxycardium chloroplast rbcL gene | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 498 | NC_047232 | Epipremnum amplissimum chloroplast, complete genome | 950 | 100.0% | 1669.56 | 0.00e+00 | 97.2% |
| 499 | AM905741 | Rhaphidophora crassifolia plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1667.58 | 0.00e+00 | 97.2% |
| 500 | AM905777 | Gonatopus angustus plastid partial rbcL gene for ribulose-biphosphate carboxylase | 945 | 99.5% | 1667.58 | 0.00e+00 | 97.2% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
The boxplot above shows the distribution of BLAST hits identity within each genus. Each data point shows the alignment identity between the query sequence and reference sequence. The analyst may wish to refer to this figure when making a subjective genus-level identification for the sample.
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Nicotiana tabacum | Did not match any candidate |
Database coverage of Taxon of Interest Nicotiana tabacumThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Nicotiana tabacum
Flag 5.1A:
The reference data supports this taxon well
28 records
There are 28 sequences in the reference database for Nicotiana tabacum at the given locus rbcL.
Global occurrence records for Nicotiana tabacum.
Database coverage of species in genus Nicotiana
Flag 5.2B:
The reference data offers some support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus rbcL Database coverage of species in genus Nicotiana that occur in country of origin Indonesia
Flag 5.3A:
The reference data supports species in this genus well, when we evaluate only species that occur in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus rbcL |
||||||||||
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |